circad | circRNAs associated with diseases
rno circ 0004058
 Genen/aOrganismRat
 Genome Locusn/aBuildn/a
 DiseaseNeuropathyICD-10 Hereditary and idiopathic neuropathy (G60)
 DBLinkLink to databasePMID28420964
 Experimental Method
 Sample TypeTissuesComparison12 rats for SNI and sham operation. At 14 days after operation, three rats were randomly selected in each group and deeply anesthetized with isoflurane after the behavioral test.
 Method for EstimationQuantitative PCRPCR Details
 Primers
(Experimented)
Forward

AAATTATCTCGAATGGAGTG

Reverse

GCGAGCATCTCTTCGGACTT

StatisticsFold Change : Upregulated
pvalue : p<0.05
 Citation
Zhou, J, Xiong, Q, Chen, H, Yang, C, Fan, Y (2017). Identification of the Spinal Expression Profile of Non-coding RNAs Involved in Neuropathic Pain Following Spared Nerve Injury by Sequence Analysis. Front Mol Neurosci, 10:91.